View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_high_105 (Length: 331)
Name: NF0846_high_105
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0846_high_105 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 139 - 313
Target Start/End: Complemental strand, 26322164 - 26321988
Alignment:
| Q |
139 |
aactcttgaagttaagataaacgttaagagcatgtggttaagcatataggccaaagtgaggaattcacgaagaa-ttaattcaggaattaaactactaat |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
26322164 |
aactcttgaagttaagataaacgttaagagcatgtggttaagcatataggccaaagtgaggaattcacgaagaatttaattcaggaatgaaactactaat |
26322065 |
T |
|
| Q |
238 |
t-aaaagatagtagtcataaggaaagacaaattaaaaaactattccatgtgatcagattcaaaactaggtgtcgttc |
313 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26322064 |
taaaaagatagtagtcataaggaaagacaaattaaaaaactattccatgtgatcagattcaaaactaggtgtcgttc |
26321988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 30 - 110
Target Start/End: Complemental strand, 26322277 - 26322197
Alignment:
| Q |
30 |
aataaaaaatgacacatagctttcaaactacttcataattaatattctattcactccaatccctcaaaactctcaatcaca |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26322277 |
aataaaaaatgacacatagctttcaaactacttcataattaatattctattcactccaatccctcaaaactctcaatcaca |
26322197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 40 times since January 2019
Visitors: 6042