View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_high_106 (Length: 327)
Name: NF0846_high_106
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0846_high_106 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 101; Significance: 5e-50; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 83 - 230
Target Start/End: Original strand, 17935751 - 17935896
Alignment:
| Q |
83 |
agaaatattaatcattaattaagatgattaactttccatagatcgcacggtgcaactactagttaatnnnnnnnntggagagctaacttgtgacagataa |
182 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |||||| ||||||| ||||||||||||||||| |
|
|
| T |
17935751 |
agaaatattaatcattaattaagataactaactttccatagatcgcacggtgcaactac--gttaataaaaaaaatggagaggtaacttgtgacagataa |
17935848 |
T |
|
| Q |
183 |
ttttacaaacaagtgtttattggcatacaacaagtataaatgttctgt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17935849 |
ttttacaaacaagtgtttattggcatacaacaagtataaatgttctgt |
17935896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 30 - 98
Target Start/End: Original strand, 17935658 - 17935726
Alignment:
| Q |
30 |
caaagatacgatggattagtctttttgatttttatatatgataatgttattttagaaatattaatcatt |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17935658 |
caaagatacgatggattagtctttttgatttttatatatgataatgttattttagaaatattaatcatt |
17935726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 50 times since January 2019
Visitors: 6042