View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0846_high_116 (Length: 314)

Name: NF0846_high_116
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0846_high_116
NF0846_high_116
[»] chr4 (1 HSPs)
chr4 (72-269)||(40979553-40979752)


Alignment Details
Target: chr4 (Bit Score: 161; Significance: 7e-86; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 72 - 269
Target Start/End: Complemental strand, 40979752 - 40979553
Alignment:
72 agatgaaagagcagggcacgctacatagattcctgttnnnnnnnnttt--ctttcaaggactataatgattcatgagtcaagaatcacttttgcaaagtt 169  Q
    |||||||||||||||||||||||||||||||||||||        |||  ||||||||||||||| ||||||||||||||||||||||||||||||||||    
40979752 agatgaaagagcagggcacgctacatagattcctgttaatttttttttttctttcaaggactatagtgattcatgagtcaagaatcacttttgcaaagtt 40979653  T
170 tgcattgtggtggtgttcttgaaattgatgattaattgatttcaaatctgaatcgtaatagtgtattaatttcacgagttaattaagtctgccagattct 269  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40979652 tgcattgtggtggtgttcttgaaattgatgattaattgatttcaaatctgaatcgtaatagtgtattaatttcacgagttaattaagtctgccagattct 40979553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 146 times since January 2019
Visitors: 6051