View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_high_123 (Length: 303)
Name: NF0846_high_123
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0846_high_123 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 2e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 1 - 146
Target Start/End: Original strand, 34570856 - 34571001
Alignment:
| Q |
1 |
ttgggcgagttttccttcaagcacgagccacatgtctgccaattctgtggatgtatgctttaggaaattgatctcagcatgtccaagtgaaacatcctgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34570856 |
ttgggcgagttttccttcaagcacgacccacatgtctgccaattctgtggatgtatgctttaggaaattgatctcagcatgtccaagtgaaacatcctgg |
34570955 |
T |
|
| Q |
101 |
tcaaatggaccgtcaaaatcaaaaacttccacatacaaaactgatg |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34570956 |
tcaaatggaccgtcaaaatcaaaaacttccacatacaaaactgatg |
34571001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 157 times since January 2019
Visitors: 6046