View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_high_124 (Length: 299)
Name: NF0846_high_124
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0846_high_124 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 95 - 159
Target Start/End: Complemental strand, 34285421 - 34285357
Alignment:
| Q |
95 |
acatgaacagattaatgttggaagacttgataatgtttgtactagtggtacgtaaaattagtaac |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34285421 |
acatgaacagattaatgttggaagacttgataatgtttgtactagtggtacgtaaaattagtaac |
34285357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 190 - 224
Target Start/End: Original strand, 29377548 - 29377582
Alignment:
| Q |
190 |
acatgccttcttttacacctatcttcttcttctct |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
29377548 |
acatgccttcttttacacctatcttcttcttctct |
29377582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 94 times since January 2019
Visitors: 6050