View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0846_high_127 (Length: 294)

Name: NF0846_high_127
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0846_high_127
NF0846_high_127
[»] chr4 (1 HSPs)
chr4 (3-151)||(15508905-15509053)


Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 3 - 151
Target Start/End: Complemental strand, 15509053 - 15508905
Alignment:
3 gtggattaatataaaagaaaaacctatgaaatacataaatgtacctgttttccataaatatgaatatgaatgaaagataaaaaagaagaatcttctatac 102  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15509053 gtggattaatataaaagaaaaacgtatgaaatacataaatgtacctgttttccataaatatgaatatgaatgaaagataaaaaagaagaatcttctatac 15508954  T
103 aaagctcatcttccttcccctctgagcccccttgagccaaagcacaaag 151  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
15508953 aaagctcatcttccttcccctctgagcccccttgagccaaagcacaaag 15508905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 142 times since January 2019
Visitors: 6051