View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_high_129 (Length: 292)
Name: NF0846_high_129
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0846_high_129 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 84; Significance: 6e-40; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 154 - 241
Target Start/End: Complemental strand, 43387668 - 43387581
Alignment:
| Q |
154 |
gcaagtagcaactagcaaaatcactcattcataaaagaccaaattctaattaaatgcgatggacatgtattttggaaaccctaattct |
241 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43387668 |
gcaaatagcaactagcaaaatcactcattcataaaagaccaaattctaattaaatgcgatggacatgtattttggaaaccctaattct |
43387581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 6 - 54
Target Start/End: Complemental strand, 43387816 - 43387768
Alignment:
| Q |
6 |
ctcgaagaatatgtttggaaggatccttcttctttcacaattcaaacag |
54 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43387816 |
ctcgacgaaaatgtttggaaggatccttcttctttcacaattcaaacag |
43387768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 237 - 288
Target Start/End: Complemental strand, 28829013 - 28828962
Alignment:
| Q |
237 |
attcttccaccttacaactcaataacaacagattcattacctcagaaaactg |
288 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28829013 |
attcttccaccttacaactcaataacaaccgattcattacctcagaaaactg |
28828962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University