View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_high_131 (Length: 289)
Name: NF0846_high_131
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0846_high_131 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 4 - 221
Target Start/End: Complemental strand, 46491601 - 46491384
Alignment:
| Q |
4 |
ggaggagcacagagtgaagaccgaagagagctatgcagtagtagtgtggcattaaatgttcgtgtgcccaaccagatttaatgtttaccactatattcct |
103 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46491601 |
ggaggaacacaaagtgaagaccgaagagagctatgcagtagtagtgtggcattaaatgttcgtgtgcccaaccagatttaatgtttaccactatattcct |
46491502 |
T |
 |
| Q |
104 |
tctgattctatatatatccttccaattaccttggcaggtgttagatatcatgagttgttaaagaaattaaaggaagtctaccaaaatttattaaaataca |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46491501 |
tctgattctatatatatccttccaattaccttggcaggtgttagatatcatgagttgttaaagaaattaaaggaagtctaccaaaatttattaaaataca |
46491402 |
T |
 |
| Q |
204 |
caagtatgaactcttcgg |
221 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
46491401 |
caagtatgaactcatcgg |
46491384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 158 - 218
Target Start/End: Complemental strand, 46498760 - 46498700
Alignment:
| Q |
158 |
ttgttaaagaaattaaaggaagtctaccaaaatttattaaaatacacaagtatgaactctt |
218 |
Q |
| |
|
||||||||||||||| ||||||||| ||||| ||||||| |||||||| ||||||||||| |
|
|
| T |
46498760 |
ttgttaaagaaattagaggaagtctgtcaaaaattattaacatacacaattatgaactctt |
46498700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University