View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_high_133 (Length: 285)
Name: NF0846_high_133
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0846_high_133 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 47 - 244
Target Start/End: Complemental strand, 52242522 - 52242325
Alignment:
Q |
47 |
ggcctcctccgcctgagagcgagaaaccggtgtttggtgaggatagtggagttaggaggagaagaaaaggaaaagatttctttgatgatatatttggagg |
146 |
Q |
|
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
52242522 |
ggcctcctccgcctgagagcgagaaaccagtgtttggtgaggatagtggagctaggaggagaagaaaaggaaaagatttttttgatgatatatttggagg |
52242423 |
T |
 |
Q |
147 |
agaagattcacagtctcaaactccaagtgggtgttcaacaccaaagagacgtgatggtgctgctttcagtcctgctcttcgaccacttgcttcatctc |
244 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
52242422 |
agaagattcacagtctcaaactccaagtgggtgttcaacaccaaagagacgtgatggtgctgctttcagtcctgctcttcgaccacttgcttcttctc |
52242325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 38 times since January 2019
Visitors: 6047