View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_high_156 (Length: 254)
Name: NF0846_high_156
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0846_high_156 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 34 - 253
Target Start/End: Complemental strand, 11399480 - 11399261
Alignment:
| Q |
34 |
aaaggcgaaagtaaaaggatttaaattcagagtggagttatcagccgttagtctgtttggagttgaagccaaatgggtgagttcgtatataattgtcatt |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11399480 |
aaaggcgaaagtaaaaggatttaaattcagagtggagttatcagccgttagtctgtttggagttgaagccaaatgggtgagttcgtatataattgtcatt |
11399381 |
T |
|
| Q |
134 |
gtatgttcccaaatcgctgctgttctgttttgtagaggatggtcgtggatttgaagttgggtgtttttgttagcacagcaattacttgttactcaagaaa |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11399380 |
gtatgttcccaaatcgctgctgttctgttttgtagaggatggtcgtggatttgaagttgggtgtttttgttagcacagcaattacttgttactcaagaaa |
11399281 |
T |
|
| Q |
234 |
tgaatgatttatagagaaat |
253 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
11399280 |
tgaatgatttatagagaaat |
11399261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 972 times since January 2019
Visitors: 6040