View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_high_159 (Length: 252)
Name: NF0846_high_159
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0846_high_159 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 31 - 242
Target Start/End: Original strand, 25977740 - 25977951
Alignment:
Q |
31 |
ctttggtggcttcggatgcaagaaactgattcacatggtaaaagtagcttttaattatagttgaacaagaatgaagtatgctagtgagacataccaaata |
130 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25977740 |
ctttggtggcttcggatgcaagaaactgattcacatggtaaaagtaacttttaattatagttgaacaagaatgaagtatgctagtgagacataccaaata |
25977839 |
T |
 |
Q |
131 |
aacataagcaatttcaataattatagcataacgtacttcttcaatggagtgaccattggaggatataagagatgatagttcctgaaagctagcctcagaa |
230 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25977840 |
aacataagcaatttcaataattatagcataacgtacttcttcaatggagtgaccattggaggatataagagatgatagttcctgaaagctagcctcagaa |
25977939 |
T |
 |
Q |
231 |
cccgacctatgc |
242 |
Q |
|
|
|||||||||||| |
|
|
T |
25977940 |
cccgacctatgc |
25977951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 104 times since January 2019
Visitors: 6045