View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_high_163 (Length: 252)
Name: NF0846_high_163
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0846_high_163 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 31596248 - 31596004
Alignment:
| Q |
1 |
cgtgcttgatgatattatatcttggcttgatgatcatagcagcacaaaaaacaaagtttaagcattttgttaatttgtaatatttgttacaaaactagtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31596248 |
cgtgcttgatgatattatatcttggcttgatgatcatagcagcacaaaaaacaaagtttaagcattttgttaatttgtaatatttgttacaaaactagtc |
31596149 |
T |
|
| Q |
101 |
atcagcacaaatactttagtgtttgtatgtattcatgttctatctcatgagaactagtcaaatttttactttaatgtttaatgcttgaaaacaaccgaca |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31596148 |
attagcacaaatactttagtgtttgtatgtattcatgttctatctcatgagaactagtcaaatttttactttaatgtttaatgcttgaaaacaaccgaca |
31596049 |
T |
|
| Q |
201 |
tgtatttggttggatgtatctacttattgcaaataatattattcg |
245 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
31596048 |
tgtatttggttggatgtatctatttattgcaaataatattgttcg |
31596004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 138 times since January 2019
Visitors: 6045