View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_high_167 (Length: 251)
Name: NF0846_high_167
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0846_high_167 |
 |  |
|
| [»] chr5 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 13 - 251
Target Start/End: Original strand, 29469784 - 29470022
Alignment:
| Q |
13 |
aatatgtgtccgtcttctttaaaagaaatgtgttattttatcaagtgtgtatgtggtgtgtacgggcctataagagaaagaaggttgtaccaaagccata |
112 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29469784 |
aatatgtgtccgtctcctttaaaagaaatgtgttatttcatcaagtgtgtatgtggtgtgtacgggcctataagagaaagaaggttgtaccaaagccata |
29469883 |
T |
 |
| Q |
113 |
atccaatgatccaatgaattggcagtaggcttggaacttggaagggaatgcgtcctttaccgtgaaggatatccaaattgtgatgtcagctgaacatgtc |
212 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29469884 |
atccaatgatccaatgaattggaagtaagcttgaaacttggaagggaatgcgtccttcaccgtgaaggatatccaaattgtgatgtcagctgaacatgta |
29469983 |
T |
 |
| Q |
213 |
acaaattgccccttcaagcatcgtgccttgaattctgat |
251 |
Q |
| |
|
||| | ||||||||||||||| |||| ||||||| |||| |
|
|
| T |
29469984 |
acagagtgccccttcaagcattgtgctttgaattttgat |
29470022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 162 - 251
Target Start/End: Original strand, 29462152 - 29462241
Alignment:
| Q |
162 |
gcgtcctttaccgtgaaggatatccaaattgtgatgtcagctgaacatgtcacaaattgccccttcaagcatcgtgccttgaattctgat |
251 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||||| || |||||||||||| |||||| ||||||| ||||||||||||| |||| |
|
|
| T |
29462152 |
gcgtccttcaccgcgaaggatatccaaattgtgatgtcaactaaacatgtcacaaggtgccccatcaagcaacgtgccttgaattttgat |
29462241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 16 - 50
Target Start/End: Original strand, 29481622 - 29481656
Alignment:
| Q |
16 |
atgtgtccgtcttctttaaaagaaatgtgttattt |
50 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
29481622 |
atgtgtccgtctcctttaaaagaaatgtgttattt |
29481656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University