View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_high_179 (Length: 243)
Name: NF0846_high_179
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0846_high_179 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 115 - 222
Target Start/End: Original strand, 40077975 - 40078082
Alignment:
Q |
115 |
gaagatgatgatgatattagcatttaattaataaaagtacttcctagatggtttcattggaacataatgttattctacaccatatctcttggtacaagac |
214 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
40077975 |
gaagatgatgatgatattagcatttaattaataaaagtacttcctagatggtttcattggatcataatgttattctacaccatatctcttggtacaagac |
40078074 |
T |
 |
Q |
215 |
caaaatgt |
222 |
Q |
|
|
|||||||| |
|
|
T |
40078075 |
caaaatgt |
40078082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 40077906 - 40077958
Alignment:
Q |
1 |
taccctgctaaatcaccataataattgttatggagatgatgattcttctgtcc |
53 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40077906 |
taccctgctaaatcaccataataattgttatggagatgatgattcttctgtcc |
40077958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University