View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_high_181 (Length: 238)
Name: NF0846_high_181
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0846_high_181 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 7 - 235
Target Start/End: Complemental strand, 26485814 - 26485586
Alignment:
Q |
7 |
gtttgcactattggttacttcctcccatatatgatgagccaacaactagagaccagatcgatgtgcctatgactctgaatggtggaaacaaccaaaacga |
106 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
26485814 |
gtttgcactattggttacttcctcccatatatgatgagccaacaactagaaaccagatcgatgtgcctatgactgtgaatggtggaaacaaccaaaacga |
26485715 |
T |
 |
Q |
107 |
aatacataaaaccgtggccaattagaaacccattgtggcagcatcaaccattaaaggtgacttatgatatgaattccaatcgtgacggtcaatgacgaac |
206 |
Q |
|
|
||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26485714 |
catacatacaaccgtggccaattagaagcccattgtggcagcatcaaccattaaaggttacttatgatatgaattccaatcgtgacggtcaatgacgaac |
26485615 |
T |
 |
Q |
207 |
ccataatctaggaactgattgcatagctc |
235 |
Q |
|
|
||||||| |||||||||||||| |||||| |
|
|
T |
26485614 |
ccataatttaggaactgattgcgtagctc |
26485586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University