View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_high_188 (Length: 213)
Name: NF0846_high_188
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0846_high_188 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 42341046 - 42340840
Alignment:
| Q |
1 |
tacttagaaactcatccatgttcatggatccgaaattcttgccgctatcacagaggctgtgttggaactcgtcaagggtgagtgagtatatggatgacga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |
|
|
| T |
42341046 |
tacttagaaactcatccatgttcatggatccgaaattcttgccgctatcacagaggctgtgttggaactcgtcgagggtgagtgagtatatggatgaaga |
42340947 |
T |
 |
| Q |
101 |
ttgccttccgagcgatgaagaaatgacattgttgacgtcattcctggtcgcttcttctccttccctctgcaatgattctacctccccttgttgccaattc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42340946 |
ttgccttccgagcgatgaagaaatgacattgttgacgtcattcctgatcgcttcttctccttccctttgcaatgattctacctccccttgttgccaattc |
42340847 |
T |
 |
| Q |
201 |
atctcac |
207 |
Q |
| |
|
||||||| |
|
|
| T |
42340846 |
atctcac |
42340840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University