View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_high_194 (Length: 203)
Name: NF0846_high_194
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0846_high_194 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 22 - 179
Target Start/End: Complemental strand, 37174182 - 37174025
Alignment:
| Q |
22 |
ggagaatatactataaactttaccgtctacacgatatatgtattttaaaatgtgtaccataaacttcaacttgaagttaactgtagatattttataaaaa |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
37174182 |
ggagaatatactataaactttaccgtctacacgatatatgtattttaaaatatgtaccataaacttcaacttgaagttaacggtagatattttttaaaaa |
37174083 |
T |
|
| Q |
122 |
tatatcttgtaagttttcgatggtaaagaaagtatttcaggccattcaaatgtctgtg |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37174082 |
tatatcttgtaagttttcgatggtaaagaaagtatttcagtccattcaaatgtctgtg |
37174025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 22 times since January 2019
Visitors: 6046