View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_high_74 (Length: 386)
Name: NF0846_high_74
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0846_high_74 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-100
Query Start/End: Original strand, 82 - 267
Target Start/End: Original strand, 13669429 - 13669614
Alignment:
Q |
82 |
cagttttcaagcgacgatgaagcatcaccaagagcaatactagatgcccctgtttcaggaacagagtcagacaatagtggaagcagcagtttctcctcgt |
181 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13669429 |
cagttttcaagcgacgatgaagcatcaccaagagcaatactagatgcccctgtttcaggaacagagtcagacaatagtggaagcagcagtttctcctcgt |
13669528 |
T |
 |
Q |
182 |
actcatcggagaattcaccaccggtggagggaaaattaggttggaaggaaagtaacatgatgcaatggaaatcaatgattgatgtt |
267 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13669529 |
actcatcggagaattcaccaccggtggagggaaaattaggttggaaggaaagtaacatgatgcaatggaaatcaatgattgatgtt |
13669614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University