View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_high_75 (Length: 384)
Name: NF0846_high_75
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0846_high_75 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 1e-54; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 97 - 233
Target Start/End: Original strand, 26968998 - 26969134
Alignment:
| Q |
97 |
catcaaaaacatatactaccataaattcaaatttgttaccttggtcttgtcttttgcctctactgtcttttgcttagcagcctcagtggtttctgcagtt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| || | || ||||||||| |
|
|
| T |
26968998 |
catcaaaaacatatactaccataaattcaaatttgttaccttggtcttgtcttttgcctctactgtcttttgtttagcagcttctgctgtctctgcagtt |
26969097 |
T |
|
| Q |
197 |
ttctgtttagcagcttccgctgtctctgcagttttct |
233 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26969098 |
ttctgtttagcagcttctgctgtctctgcagttttct |
26969134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 188 - 311
Target Start/End: Original strand, 26969122 - 26969245
Alignment:
| Q |
188 |
tctgcagttttctgtttagcagcttccgctgtctctgcagttttctccttagcttcctctttcttgtcacccaagtaacccatagcccgtttcgccgcat |
287 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26969122 |
tctgcagttttctgtttagcagcttctgctgtctctgcagttttctgtttagcttcctctttcttgtcacccaagtaacccatagcccgtttcgccgcat |
26969221 |
T |
|
| Q |
288 |
caacagcagagtctttcatctcac |
311 |
Q |
| |
|
||||||||||||| |||||||||| |
|
|
| T |
26969222 |
caacagcagagtccttcatctcac |
26969245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 176 times since January 2019
Visitors: 6052