View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_high_95 (Length: 346)
Name: NF0846_high_95
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0846_high_95 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 1 - 346
Target Start/End: Original strand, 8135655 - 8136001
Alignment:
| Q |
1 |
tggaccatgccgtttcattgcaccattccttgctgagttggccaacaagtatacaaatgccatattccttaaggtggatgtggacgaattgaaggtaaca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8135655 |
tggaccatgccgtttcattgcaccattccttgctgagttggccaagaagtatacaaatgccatattccttaaggtggatgtggacgaattgaaggtaaca |
8135754 |
T |
|
| Q |
101 |
cattctaattaatttgcacaagagtttaatgaggatgtaatgtagttataaaactcatcatgttgtcacataaacctactttgtagccccatttgaaaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8135755 |
cattctaattaatttgcacaagagtttaatgaggatgtaatgtcgttataaaactaatcatgttgtcacataaacctactttgtagccccatttgaaaaa |
8135854 |
T |
|
| Q |
201 |
tgaccgtaaaatactaaagatttttattggacgtcagtgtaaaactttttgcactctgcct-aaaaaacaggaaattcgataaatagatattaatcatga |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8135855 |
tgaccgtaaaatactaaagatttttattggacgtcagtgtaaaactttttgcactctgcctaaaaaaacaggaaattcgataaatagatattaatcatga |
8135954 |
T |
|
| Q |
300 |
ataatttgttgattgaattgcagtctgttgctcaagattgggctatt |
346 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8135955 |
ataatttgttgattgaattgcagtctgttgctcaagattgggctatt |
8136001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 173 times since January 2019
Visitors: 6052