View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_high_99 (Length: 340)
Name: NF0846_high_99
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0846_high_99 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 176; Significance: 9e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 176; E-Value: 9e-95
Query Start/End: Original strand, 111 - 306
Target Start/End: Complemental strand, 20480229 - 20480034
Alignment:
Q |
111 |
gcaaggataaatatagtgttattgattactcaattttaatacatttgaataacctagataggattagctactcacagtttataaacatttacaaatagat |
210 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
20480229 |
gcaaggataaatatagtgttattgattactcaattttaatacatttgaataacctagataggattagctactcacagtttgtaaacatttacaaatagat |
20480130 |
T |
 |
Q |
211 |
ataaataaaaacatgagtaaaggataatcagttgatgtttcttggctcctaaatggatctcgctgcttcaatccttctgaaattgcatttgtgcct |
306 |
Q |
|
|
|| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
T |
20480129 |
atgaataaaaacatgagtaaaggataatcagttgatgattcttggctcctaaatggatctcgccgcttcaatccttctgaaattgcgtttgtgcct |
20480034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 160 - 218
Target Start/End: Original strand, 28485230 - 28485288
Alignment:
Q |
160 |
taacctagataggattagctactcacagtttataaacatttacaaatagatataaataa |
218 |
Q |
|
|
||||||||| ||||||||||||||| |||| ||||||| |||||||||| || ||||| |
|
|
T |
28485230 |
taacctagagaggattagctactcatagttcctaaacatatacaaatagagatgaataa |
28485288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 153 times since January 2019
Visitors: 6051