View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_low_113 (Length: 349)
Name: NF0846_low_113
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0846_low_113 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 5e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 77 - 248
Target Start/End: Original strand, 43952324 - 43952495
Alignment:
Q |
77 |
caacaatatcaaaaacaaaaacccacaacctcaaattcgattaaccaaaatgctctctggctgcaaacatcctaaaacaccatctttttccttagataac |
176 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43952324 |
caacaaaatcaaaaacaaaaacccacaacctcaaattcgattaaccaaaatgctctctggctgcaaacatcctaaaacaccatctttttccttagataac |
43952423 |
T |
 |
Q |
177 |
ggcagaaacatatcatcctctaacgccgttaacaacaataacaacaaaatcaatgatgctgcaacactagct |
248 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43952424 |
ggcagaaacatatcatcctctaacgccgttaacaacaataacaacaaaatcaatgatgctgcaacactagct |
43952495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University