View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_low_115 (Length: 345)
Name: NF0846_low_115
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0846_low_115 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 30 - 339
Target Start/End: Original strand, 37512171 - 37512480
Alignment:
Q |
30 |
ctaatgttatgtcgtatgatgttaatcatccatttaattttatgttgtattccatttcgggtgagagatttgagaagaaggtcaaattggaatggccaaa |
129 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
37512171 |
ctaatgttatgtcgtatgatgttaatcatccatttaattttatgttgtattccatgtcgggtgagagatttgagaagaaggtcaaattgaaatggccaaa |
37512270 |
T |
 |
Q |
130 |
tccattcaatgaggatgaccctcatcctggtttttacatttttggtcctgctagtattaatgatgttctatctctctatataaagattctcgtaaaaatt |
229 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
37512271 |
tccattcaatgaggatgaccctcatcctggtttttacatttttggtcctgctagtattaatgatgttctatgtctctatataaagattctcgtaaaaatt |
37512370 |
T |
 |
Q |
230 |
atggaagagttttattatgcaacccaactattgaggaaatcaaggtcattcctcgcaacccttttggttataaaactccatatcgcacccctgtttttga |
329 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37512371 |
atggaagagttttattatgcaacctaactattgaggaaatcaaggtcattcctcgcaacccttttggttataaaactccatatcgcacccctgtttttga |
37512470 |
T |
 |
Q |
330 |
tattcttgga |
339 |
Q |
|
|
||||| |||| |
|
|
T |
37512471 |
tattcatgga |
37512480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 836 times since January 2019
Visitors: 6035