View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_low_123 (Length: 336)
Name: NF0846_low_123
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0846_low_123 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 83 - 238
Target Start/End: Complemental strand, 48592086 - 48591931
Alignment:
| Q |
83 |
gagatgaagatgtccaattattggtattgctggtggacttggagggtgaggtggtaatcgtgcatgcgacttcttgtttctctttaagtaagagagaagc |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
48592086 |
gagatgaagatgtccaattattggtattgctggtggacttggagggtgaggtggtaatcgtgcatgcaacttcttgtttctctttaagtaagagagaagc |
48591987 |
T |
 |
| Q |
183 |
tgaaaaatgaaaagaaataggagcaaaatcatagctaatgagaaggaatgggaaat |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48591986 |
tgaaaaatgaaaagaaataggagcaaaatcatagctaatgagaaggaatgggaaat |
48591931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 83 - 238
Target Start/End: Complemental strand, 48601781 - 48601626
Alignment:
| Q |
83 |
gagatgaagatgtccaattattggtattgctggtggacttggagggtgaggtggtaatcgtgcatgcgacttcttgtttctctttaagtaagagagaagc |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
48601781 |
gagatgaagatgtccaattattggtattgctggtggacttggagggtgaggtggtaatcgtgcatgcaacttcttgtttctctttaagtaagagagaagc |
48601682 |
T |
 |
| Q |
183 |
tgaaaaatgaaaagaaataggagcaaaatcatagctaatgagaaggaatgggaaat |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48601681 |
tgaaaaatgaaaagaaataggagcaaaatcatagctaatgagaaggaatgggaaat |
48601626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 49; Significance: 5e-19; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 83 - 238
Target Start/End: Original strand, 23232246 - 23232398
Alignment:
| Q |
83 |
gagatgaagatgtccaattattggtattgctggtggacttggagggtgaggtggtaatcgtgcatgcgacttcttgtttctctttaagtaagagagaagc |
182 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| |||| ||||| ||| || || |||||||||||||| ||| |||| ||| |
|
|
| T |
23232246 |
gagatgaagatgtccaattattggtattgttggtggacttggagg--gagg-ggtaaatgtggttgtgatttcttgtttctcttaaagacggagaaaagt |
23232342 |
T |
 |
| Q |
183 |
tgaaaaatgaaaagaaataggagcaaaatcatagctaatgagaaggaatgggaaat |
238 |
Q |
| |
|
| | || |||||||| ||||||| ||||||||||||| |||||||||| ||||| |
|
|
| T |
23232343 |
gggagaaggaaaagaagaaggagcacaatcatagctaataagaaggaatgagaaat |
23232398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 83 - 134
Target Start/End: Original strand, 23224913 - 23224964
Alignment:
| Q |
83 |
gagatgaagatgtccaattattggtattgctggtggacttggagggtgaggt |
134 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
23224913 |
gagatgaagatgaccaattattggtattgctagtggacttggagggtaaggt |
23224964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University