View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_low_126 (Length: 331)
Name: NF0846_low_126
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0846_low_126 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 54 - 254
Target Start/End: Complemental strand, 4805471 - 4805271
Alignment:
| Q |
54 |
tagcataggcaggtaagcaaagaaagaaagcaaaatacacactttctctctctatagtttctttctctttctagttctagcttatagtgttgtctgtaat |
153 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4805471 |
tagcatgggcaggtaagcaaagaaagaaagcaaaatacacactttctctctctatattttctctctctttctagttctagcttatagtgttgtctgtaat |
4805372 |
T |
 |
| Q |
154 |
ctataaaagttagatttttatactacctttgttgtttatggttactacccaattggtgaaattggtttttattgtctaatctatatagcatttgatgcta |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4805371 |
ctataaaagttagatttttatactacctttgttgtttatggttactacccaattggtgaaattggtttttattgtctaatctatatagcatttgatgcta |
4805272 |
T |
 |
| Q |
254 |
a |
254 |
Q |
| |
|
| |
|
|
| T |
4805271 |
a |
4805271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University