View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_low_132 (Length: 322)
Name: NF0846_low_132
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0846_low_132 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 95; Significance: 2e-46; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 74 - 193
Target Start/End: Complemental strand, 6738900 - 6738786
Alignment:
Q |
74 |
cacagaaatgcataatgtgtgataataagagctcaaaatgggagagggaaataacaaattataaagatagctttgaagtcacctaaattgaaatgagcag |
173 |
Q |
|
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
6738900 |
cacagaaatgcataatgtgtgataa---gagctcaaaatgggagagggaaataacaaattata--gatagctttgaagtcacctaaattgaaatgagcag |
6738806 |
T |
 |
Q |
174 |
ttgaaatagttttacccttg |
193 |
Q |
|
|
|||||||||||||||||||| |
|
|
T |
6738805 |
ttgaaatagttttacccttg |
6738786 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University