View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_low_134 (Length: 319)
Name: NF0846_low_134
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0846_low_134 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 82; Significance: 1e-38; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 101 - 234
Target Start/End: Original strand, 8134991 - 8135128
Alignment:
Q |
101 |
aggcatgctaatgttggacactaacacatcacccacacatgtacattcaatcgcnnnnnnnnn----cttaaattattagaagtgtatatacgtatttat |
196 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| ||| |
|
|
T |
8134991 |
aggcatgctaatgttggacactaacacatcacccacacatgtacattcaatcgctttttttttttctcttaaattattagaagtgtatatgcgtatgtat |
8135090 |
T |
 |
Q |
197 |
caatgttgtgtctgatatatgtgtcgacgtgtcctatg |
234 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||| |
|
|
T |
8135091 |
caatgttgtgtctgatatacgtgtcgacgtgtcctatg |
8135128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 878 times since January 2019
Visitors: 6037