View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_low_140 (Length: 314)
Name: NF0846_low_140
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0846_low_140 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 7e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 72 - 269
Target Start/End: Complemental strand, 40979752 - 40979553
Alignment:
Q |
72 |
agatgaaagagcagggcacgctacatagattcctgttnnnnnnnnttt--ctttcaaggactataatgattcatgagtcaagaatcacttttgcaaagtt |
169 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
40979752 |
agatgaaagagcagggcacgctacatagattcctgttaatttttttttttctttcaaggactatagtgattcatgagtcaagaatcacttttgcaaagtt |
40979653 |
T |
 |
Q |
170 |
tgcattgtggtggtgttcttgaaattgatgattaattgatttcaaatctgaatcgtaatagtgtattaatttcacgagttaattaagtctgccagattct |
269 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40979652 |
tgcattgtggtggtgttcttgaaattgatgattaattgatttcaaatctgaatcgtaatagtgtattaatttcacgagttaattaagtctgccagattct |
40979553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 29 times since January 2019
Visitors: 6042