View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_low_144 (Length: 310)
Name: NF0846_low_144
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0846_low_144 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 109; Significance: 8e-55; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 182 - 298
Target Start/End: Complemental strand, 17221887 - 17221771
Alignment:
Q |
182 |
gctataaataaatatctcactctgctcaatcaaatcaaatgttaagttaagtagtatatcatattgtttaatgtacattatcattctccaccatatgctt |
281 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
17221887 |
gctataaataaatatctcactctgctcaatcaaatccaattttaagttaagtagtatatcatattgtttaatgtacattatcattctccaccatatgctt |
17221788 |
T |
 |
Q |
282 |
caagaggtccctatctc |
298 |
Q |
|
|
||||||||||||||||| |
|
|
T |
17221787 |
caagaggtccctatctc |
17221771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University