View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_low_150 (Length: 297)
Name: NF0846_low_150
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0846_low_150 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 54 - 254
Target Start/End: Complemental strand, 4805471 - 4805271
Alignment:
Q |
54 |
tagcataggcaggtaagcaaagaaagaaagcaaaatacacactttctctctctatagtttctttctctttctagttctagcttatagtgttgtctgtaat |
153 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
4805471 |
tagcatgggcaggtaagcaaagaaagaaagcaaaatacacactttctctctctatattttctctctctttctagttctagcttatagtgttgtctgtaat |
4805372 |
T |
 |
Q |
154 |
ctataaaagttagatttttatactacctttgttgtttatggttactacccaattggtgaaattggtttttattgtctaatctatatagcatttgatgcta |
253 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4805371 |
ctataaaagttagatttttatactacctttgttgtttatggttactacccaattggtgaaattggtttttattgtctaatctatatagcatttgatgcta |
4805272 |
T |
 |
Q |
254 |
a |
254 |
Q |
|
|
| |
|
|
T |
4805271 |
a |
4805271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University