View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_low_152 (Length: 297)
Name: NF0846_low_152
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0846_low_152 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 5e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 596710 - 596513
Alignment:
| Q |
1 |
taatcggtgaaattgtcgaaatattaaggttaggtgagaagtgagagtatgcttattcattcctggccattccaatttaaaggattaacgattgtgagtg |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
596710 |
taatcggtgaaattgtctaaatattaaggttaggtgagaagtgagagtatgcttattcattcctggccattccaatttaaaggattaacgagtgtgagtg |
596611 |
T |
|
| Q |
101 |
tctgtctgaattggggaattatgttaaagtaatgaaaaacaacagaaaattagagatatagaatttattcattcaaccaccaatcaaattacaacaatgt |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
596610 |
tctg----aattggggaattatgttaaagtaatgaaaaacaacagaaaattagagatatagaattcattcattcaaccaccaatcaaattacaacaatgt |
596515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 752 times since January 2019
Visitors: 6034