View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_low_154 (Length: 294)
Name: NF0846_low_154
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0846_low_154 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 3 - 151
Target Start/End: Complemental strand, 15509053 - 15508905
Alignment:
Q |
3 |
gtggattaatataaaagaaaaacctatgaaatacataaatgtacctgttttccataaatatgaatatgaatgaaagataaaaaagaagaatcttctatac |
102 |
Q |
|
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
15509053 |
gtggattaatataaaagaaaaacgtatgaaatacataaatgtacctgttttccataaatatgaatatgaatgaaagataaaaaagaagaatcttctatac |
15508954 |
T |
 |
Q |
103 |
aaagctcatcttccttcccctctgagcccccttgagccaaagcacaaag |
151 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
15508953 |
aaagctcatcttccttcccctctgagcccccttgagccaaagcacaaag |
15508905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 892 times since January 2019
Visitors: 6038