View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_low_155 (Length: 294)
Name: NF0846_low_155
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0846_low_155 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 12 - 218
Target Start/End: Complemental strand, 39066435 - 39066231
Alignment:
| Q |
12 |
agagacataggttgtgactcaactcaattatataaaatagacatcaataaagttacgtatttaattcaatatttctcaattgatatggcttcataaacgt |
111 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39066435 |
agagacataagtcgtgactcaactcaattatataaaatagacatcaatat-gttacgtattta-ttcaatatttctcaattgatatggcttcacaaacgt |
39066338 |
T |
 |
| Q |
112 |
ctgatgatggagaatttggaaagagataacacaaacttgaaaatatatatagaagaaagcaaggaaagtggaaaggaagttgtgagtcaggaagaagcag |
211 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39066337 |
ctgatgatggagaatttggaaagagatagcacaaacttgaaaatatatatagaagcaagcaaggaaagtggaaaggaagttgtgagtcaggaagaagcag |
39066238 |
T |
 |
| Q |
212 |
gtggtac |
218 |
Q |
| |
|
||||||| |
|
|
| T |
39066237 |
gtggtac |
39066231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University