View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_low_156 (Length: 294)
Name: NF0846_low_156
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0846_low_156 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 126
Target Start/End: Original strand, 43325527 - 43325652
Alignment:
| Q |
1 |
ctttaatctcaacccttatcactgaactactccttcaaatacttccattgtatttcttgatagacaattgtgaaaacttatactagcaaaatatgttttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43325527 |
ctttaatctcaacccttatcactgaactactccttcaaatacttccattttatttcttgatagacaattgtgaaaacttatactagcaaaatatgttttg |
43325626 |
T |
 |
| Q |
101 |
ttaatctttttaaaagttaatcaaaa |
126 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
43325627 |
ttaatctttttaaaagttaatcaaaa |
43325652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 125 - 227
Target Start/End: Original strand, 43325765 - 43325867
Alignment:
| Q |
125 |
aaaggtcaatatgctaacaactatattaatcacgtttcttatttaaataaaattataaatcacgttataaagtgcatatgccaagggctatgcactataa |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43325765 |
aaaggtcaatatgctaacaactatattaatcacgtttcttatttaaataaaattattaatcacgttataaagtgcatatgccaagggctatgcactataa |
43325864 |
T |
 |
| Q |
225 |
ttt |
227 |
Q |
| |
|
||| |
|
|
| T |
43325865 |
ttt |
43325867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University