View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0846_low_169 (Length: 273)

Name: NF0846_low_169
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0846_low_169
NF0846_low_169
[»] chr4 (2 HSPs)
chr4 (192-248)||(41331139-41331195)
chr4 (38-72)||(41331048-41331082)


Alignment Details
Target: chr4 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 41331139 - 41331195
Alignment:
192 attgatatatgttaaaactcaagtccacacccctgctttttcgaggtgttgtctgtt 248  Q
    |||||||||||||||||||||||||||||||||| ||||||| | || |||||||||    
41331139 attgatatatgttaaaactcaagtccacacccctactttttcaaagtattgtctgtt 41331195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 38 - 72
Target Start/End: Original strand, 41331048 - 41331082
Alignment:
38 agttagatttttgatggaaacaattcttgttcaaa 72  Q
    |||||||||||||||||||||||||||||||||||    
41331048 agttagatttttgatggaaacaattcttgttcaaa 41331082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 811 times since January 2019
Visitors: 6035