View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_low_169 (Length: 273)
Name: NF0846_low_169
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0846_low_169 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 41331139 - 41331195
Alignment:
Q |
192 |
attgatatatgttaaaactcaagtccacacccctgctttttcgaggtgttgtctgtt |
248 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||||||| | || ||||||||| |
|
|
T |
41331139 |
attgatatatgttaaaactcaagtccacacccctactttttcaaagtattgtctgtt |
41331195 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 38 - 72
Target Start/End: Original strand, 41331048 - 41331082
Alignment:
Q |
38 |
agttagatttttgatggaaacaattcttgttcaaa |
72 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |
|
|
T |
41331048 |
agttagatttttgatggaaacaattcttgttcaaa |
41331082 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University