View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0846_low_170 (Length: 269)

Name: NF0846_low_170
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0846_low_170
NF0846_low_170
[»] chr1 (1 HSPs)
chr1 (9-241)||(28404778-28405010)


Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 9 - 241
Target Start/End: Complemental strand, 28405010 - 28404778
Alignment:
9 agcacagacatgattctgcccggctgcaacgtgagagtaggcggtggtcctgtatgctggtggaaccaaaatgggatctgcgttttgcttagaagttgca 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
28405010 agcacagacatgattctgcccggctgcaacgtgagagtaggcggtggtcctgtatgccggtggaaccaaaatgggatctgcgttttgcttagaagttgca 28404911  T
109 gcccaacaaaaaacttgtgaagtgttggctaaaatgccgcaaagaaaaccttcaccaccagaaagtgctgacatggcaggtatgttattaacatacgagg 208  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28404910 gcccaacaaaaaacttgggaagtgttggctaaaatgccgcaaagaaaaccttcaccaccagaaagtgctgacatggcaggtatgttattaacatacgagg 28404811  T
209 aagaagaaggagtttgtggtgaagttgtgtttt 241  Q
    |||||||||||||||||||||||||||||||||    
28404810 aagaagaaggagtttgtggtgaagttgtgtttt 28404778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 17 times since January 2019
Visitors: 6041