View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_low_173 (Length: 266)
Name: NF0846_low_173
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0846_low_173 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 30 - 266
Target Start/End: Original strand, 30467785 - 30468021
Alignment:
Q |
30 |
ccatgtgcaattaatcgcttattatatcaccatgttgaaacacaagaatatcgtctcacgtgggaccttatagaatctcatgttaaataccattaccatt |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30467785 |
ccatgtgcaattaatcgcttattatatcaccatgttgaaacacaagaatatcgtctcacgtgggaccttatagaatctcatgttaaataccattaccatt |
30467884 |
T |
 |
Q |
130 |
ctcaattaacaacctcatcaaaaccatcatcatcacttaactagttttaattaattctctcttgccctatagtgagcttcatggcaaagaaaaccattat |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30467885 |
ctcaattaacaacctcatcaaaaccatcatcatcacttaactagttttaattaattctctcttgccctatagtgagcttcatggcaaagaaaaccattat |
30467984 |
T |
 |
Q |
230 |
gttaagctttcttgtttttctcattcttgtgcaaaat |
266 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |
|
|
T |
30467985 |
gttaagctttcttgtttttctcattcttgtgcaaaat |
30468021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University