View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_low_177 (Length: 261)
Name: NF0846_low_177
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0846_low_177 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 40 - 243
Target Start/End: Original strand, 47172127 - 47172330
Alignment:
Q |
40 |
aatacaacataagagggggtttctgaaactcatacaaactttcctcattataatatgttgattcaatttattggtccgcagtgtgtggccactagaccac |
139 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || ||||||||||||||||| |
|
|
T |
47172127 |
aatacaacataagagggggtttctgaaactcatacaaactttcctcattataatatgttgattcaatttattggtctgcggtatgtggccactagaccac |
47172226 |
T |
 |
Q |
140 |
tcttctataaaaagaaatcatggttttgaagtgaggtgaatcaactcaacttcattcatgaattatatataatagtactatgagatatgcaagtgattca |
239 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47172227 |
tcttctataagaagaaatcatggttttgaagtgaggtgaatcaactcaacttcattcatgaattatatataatagtactatgagatatgcaagtgattct |
47172326 |
T |
 |
Q |
240 |
tctc |
243 |
Q |
|
|
|||| |
|
|
T |
47172327 |
tctc |
47172330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University