View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_low_178 (Length: 260)
Name: NF0846_low_178
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0846_low_178 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 30668330 - 30668100
Alignment:
Q |
1 |
caaggtcattgcttaagagtgaatgagaaatgtagcaactctatgattgccacgtggcagcttggtaatcttcattgtgtggacgttatggtttcaatgg |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30668330 |
caaggtcattgcttaagagtgaatgagaaatgtagcaactctatgattgccacgtggcagcttggtaatcttcattgtgtggacgttatggtttcaatga |
30668231 |
T |
 |
Q |
101 |
ccaatcctattgttacaccctatcaattaatcagctaatataaatccctcaatttgatcacaaatttgcatagaataattttcttcaatttcaactacct |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| || |
|
|
T |
30668230 |
ccaatcctattgttacaccctatcaattaatcagctaatataaatccctcaatttgatcacaaatttgcatagaataatttgcttcaatttcaactatct |
30668131 |
T |
 |
Q |
201 |
ttctcttttgtgtaataccaatcagtgcagt |
231 |
Q |
|
|
|||||||||||| |||||||||||||||||| |
|
|
T |
30668130 |
ttctcttttgtgcaataccaatcagtgcagt |
30668100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 855 times since January 2019
Visitors: 6036