View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_low_181 (Length: 259)
Name: NF0846_low_181
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0846_low_181 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 17 - 222
Target Start/End: Original strand, 53620628 - 53620833
Alignment:
| Q |
17 |
attattctaagattttttaaatattgagattgagatcaccagtgtactcccttaccaagtgaggtttctttttatcttccattttaataataggccggaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
53620628 |
attattctaagattttttaaatattgagattgagatcaccagtgtactctcttaccaagtgaggtttctttttatcttccattttaataataggcaggaa |
53620727 |
T |
 |
| Q |
117 |
ccaagggtccaaggcaaccatggcatgatctacattgcaaaatcgaagggcctgctgcatatgatatactaactaattttgagcagcgctggaagaaagc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53620728 |
ccaagggtccaaggcaaccatggcatgatctacattgcaaaatcgaagggcctgctgcatatgatatactaactaattttgagcagcgctggaagaaagc |
53620827 |
T |
 |
| Q |
217 |
caccag |
222 |
Q |
| |
|
|||||| |
|
|
| T |
53620828 |
caccag |
53620833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 125 - 184
Target Start/End: Complemental strand, 36841127 - 36841068
Alignment:
| Q |
125 |
ccaaggcaaccatggcatgatctacattgcaaaatcgaagggcctgctgcatatgatata |
184 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||| || ||||||||||||||| |
|
|
| T |
36841127 |
ccaaggcaaccatggcatgacttacattgcaaaattgaaggtccggctgcatatgatata |
36841068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University