View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_low_182 (Length: 259)
Name: NF0846_low_182
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0846_low_182 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 29 - 183
Target Start/End: Complemental strand, 3644945 - 3644791
Alignment:
| Q |
29 |
atatatttgggatcacaccttttggtaagtcaacttatcaacccatgttccaattatgggaccaaacaatgcaatggaagcagattcaacagcaccatat |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3644945 |
atatatttgggatcacaccttttggtaagtcaacttatcaacccatgttccaattatgggaccaaacaatgcaatggaagcagattcaacagcaccatat |
3644846 |
T |
 |
| Q |
129 |
attgctgcatagagcagtgagtctggccaaatactgatcatatataaaccaacag |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3644845 |
attgctgcatagagcagtgagtctggccaaatactgatcatatataaaccaacag |
3644791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 35 - 183
Target Start/End: Complemental strand, 3635507 - 3635359
Alignment:
| Q |
35 |
ttgggatcacaccttttggtaagtcaacttatcaacccatgttccaattatgggaccaaacaatgcaatggaagcagattcaacagcaccatatattgct |
134 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3635507 |
ttgggatcacaccttcacataagtcaacttatcaacccatgttccaatcaaaggaccaaacaatgcaatggaagcagattcaacagccccatatattgct |
3635408 |
T |
 |
| Q |
135 |
gcatagagcagtgagtctggccaaatactgatcatatataaaccaacag |
183 |
Q |
| |
|
||||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3635407 |
gcatacaacagtgagtctggccaaatactgatcatatataaaccaacag |
3635359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University