View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_low_183 (Length: 258)
Name: NF0846_low_183
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0846_low_183 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 102 - 247
Target Start/End: Complemental strand, 52242225 - 52242075
Alignment:
| Q |
102 |
gcctcaaacaaatttaaagacaattcatcatttcgccaacaagttcactttaaaaacatattttaaagggaacggtggtgtattttattctcattggatg |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
52242225 |
gcctcaaacaaatttaaagacaattcatcatttcgccaacaagttcactttaaaaccatattttaaagggaacggcggtgtattttattctcattggatg |
52242126 |
T |
 |
| Q |
202 |
tcaatgtaaaac-----tacattgacactacatgtctaattcattttctct |
247 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
52242125 |
tcaatgtaaaactagtttacattgacagtacatgtctaattcattttctct |
52242075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 52242300 - 52242265
Alignment:
| Q |
1 |
tttctttttcacttccttcaccttctctttcaacta |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
52242300 |
tttctttttcacttccttcaccttctctttcaacta |
52242265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University