View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_low_186 (Length: 256)
Name: NF0846_low_186
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0846_low_186 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 28 - 256
Target Start/End: Original strand, 8893784 - 8894012
Alignment:
Q |
28 |
aagtttcacacccaccaccccataattctcatccaacaccaaaccattcaaaacatccaccgaaactggaaccggcacgcctcctaaaactggtgatacc |
127 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8893784 |
aagtttcacacccaccaccccataattctcatccaacaccaaaccattcaaaacatccaccgaaactggaaccggcacgcctcctaaaactggtgatacc |
8893883 |
T |
 |
Q |
128 |
gacacggtttcatgcttctccaagtaaagcgacggaagcatatgatgaggtgtaatcggatggtttctatatgacacaaaggtggaaagcctgtcaaagt |
227 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8893884 |
gacacggtttcatgcttctccaagtaaagcgacggaagcatatgatgaggtgtaatcggatggtttctatatgacacaaaggtggaaagcctgtcaaagt |
8893983 |
T |
 |
Q |
228 |
aaatggatactcgcttgtttggattcctt |
256 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
8893984 |
aaatggatactcgcttgtttggattcctt |
8894012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 185 times since January 2019
Visitors: 6046