View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_low_193 (Length: 252)
Name: NF0846_low_193
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0846_low_193 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 52 - 252
Target Start/End: Complemental strand, 38630013 - 38629813
Alignment:
| Q |
52 |
ggagcaacaaaagatacgaaccaatgcatagagaactaggtgcatttatgtccaattgtaggtctctttcttttctttctcaaattctagttacaatcta |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38630013 |
ggagcaacaaaagatacgaaccaatgcatagagaactaggtgcatttatgtccaattgtaggtctctttcttttctttctcaaattctagttacaatcta |
38629914 |
T |
|
| Q |
152 |
gcttttatacggaggcaaaccaatatatttgctaatagttattagagaaagaagagaagatgattacgagattacttgagtcacaagctagctactatta |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38629913 |
gcttttatacggaggcaaaccaatatatttgctaatagttattagagaaagaagagaagatgattacgagattacttgagtcacaagctagctactatta |
38629814 |
T |
|
| Q |
252 |
a |
252 |
Q |
| |
|
| |
|
|
| T |
38629813 |
a |
38629813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 836 times since January 2019
Visitors: 6035