View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0846_low_200 (Length: 251)

Name: NF0846_low_200
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0846_low_200
NF0846_low_200
[»] chr5 (3 HSPs)
chr5 (13-251)||(29469784-29470022)
chr5 (162-251)||(29462152-29462241)
chr5 (16-50)||(29481622-29481656)


Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 13 - 251
Target Start/End: Original strand, 29469784 - 29470022
Alignment:
13 aatatgtgtccgtcttctttaaaagaaatgtgttattttatcaagtgtgtatgtggtgtgtacgggcctataagagaaagaaggttgtaccaaagccata 112  Q
    ||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29469784 aatatgtgtccgtctcctttaaaagaaatgtgttatttcatcaagtgtgtatgtggtgtgtacgggcctataagagaaagaaggttgtaccaaagccata 29469883  T
113 atccaatgatccaatgaattggcagtaggcttggaacttggaagggaatgcgtcctttaccgtgaaggatatccaaattgtgatgtcagctgaacatgtc 212  Q
    |||||||||||||||||||||| |||| ||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||     
29469884 atccaatgatccaatgaattggaagtaagcttgaaacttggaagggaatgcgtccttcaccgtgaaggatatccaaattgtgatgtcagctgaacatgta 29469983  T
213 acaaattgccccttcaagcatcgtgccttgaattctgat 251  Q
    ||| | ||||||||||||||| |||| ||||||| ||||    
29469984 acagagtgccccttcaagcattgtgctttgaattttgat 29470022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 162 - 251
Target Start/End: Original strand, 29462152 - 29462241
Alignment:
162 gcgtcctttaccgtgaaggatatccaaattgtgatgtcagctgaacatgtcacaaattgccccttcaagcatcgtgccttgaattctgat 251  Q
    |||||||| |||| ||||||||||||||||||||||||| || ||||||||||||  |||||| ||||||| ||||||||||||| ||||    
29462152 gcgtccttcaccgcgaaggatatccaaattgtgatgtcaactaaacatgtcacaaggtgccccatcaagcaacgtgccttgaattttgat 29462241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 16 - 50
Target Start/End: Original strand, 29481622 - 29481656
Alignment:
16 atgtgtccgtcttctttaaaagaaatgtgttattt 50  Q
    |||||||||||| ||||||||||||||||||||||    
29481622 atgtgtccgtctcctttaaaagaaatgtgttattt 29481656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 187 times since January 2019
Visitors: 6046