View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_low_201 (Length: 251)
Name: NF0846_low_201
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0846_low_201 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 33 - 201
Target Start/End: Original strand, 40979716 - 40979884
Alignment:
| Q |
33 |
aacaggaatctatgtagcgtgccctgctctttcatctatattgacaactcaaacgtgtttgatccgtaaacctttacctacaccaataatttacatgtta |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40979716 |
aacaggaatctatgtagcgtgccctgctctttcatctatattgacaactcaaacgtgtttgatccgtaaacctttacctacaccaataatatacatgtta |
40979815 |
T |
|
| Q |
133 |
cacactcacatgaaagacactgccttattgtcctttttctccctcccccataatattttgttttctctt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40979816 |
cacactcacatgaaagacactgccttattgtcctttttctccctcccccataatattttgttttctctt |
40979884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 894 times since January 2019
Visitors: 6038