View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_low_211 (Length: 251)
Name: NF0846_low_211
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0846_low_211 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 112 - 251
Target Start/End: Original strand, 30909518 - 30909657
Alignment:
| Q |
112 |
atattgatatcattagattatacatttttatttgagtttgaattcggaactttgcaattgtgtatatcagttttaaatggtgtttgtcatttcctccata |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| |||||||||||| ||| |||||| |
|
|
| T |
30909518 |
atattgatatcattagattatacatttttatttgagtttgaactcggaactttgcaattgtgtatgtcagttttaagtggtgtttgtcaattcgtccata |
30909617 |
T |
|
| Q |
212 |
gtcaaataaaaacttgaagaaactcgttaaactacggagt |
251 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30909618 |
gttaaataaaaacttgaagaaactcgttaaactacagagt |
30909657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 16 - 106
Target Start/End: Original strand, 30909385 - 30909473
Alignment:
| Q |
16 |
ataccacgcgttttcctctcttgtgaaagttgaaaaagaaagaaagtttaaaataaattacataatttttgttgactaataagttatataa |
106 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30909385 |
ataccacgcgttttcctttcttgtgaaagttgaaaaagaaa--aagtttaaaataaattacataatttttgttgactaataagttacataa |
30909473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 41 times since January 2019
Visitors: 6047