View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_low_213 (Length: 251)
Name: NF0846_low_213
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0846_low_213 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 10 - 251
Target Start/End: Original strand, 40077648 - 40077889
Alignment:
Q |
10 |
gcagagaaagtaagtgaacgttatggtgagatgagggaagagtatgttaagaatttaggtgacatgagaagaccttttattacacattttacagggtgcc |
109 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40077648 |
gcagagaaagtaagtgaacgttatggtgagatgagggaagagtatgttaagaatttaggtgacatgagaagaccttttattacacattttacagggtgcc |
40077747 |
T |
 |
Q |
110 |
aaccttgtaatggtcaccataatccaatgtatgctgcagatgattgctggaatggcatggagagagctctcaattttgctgataatcaggtgttgcgcaa |
209 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40077748 |
aaccttgtaatggtcaccataatccaatgtatgctgcagatgattgctggaatggcatggagagagctctcaattttgctgataatcaggtgttgcgcaa |
40077847 |
T |
 |
Q |
210 |
gtttggcttcattcatccaaatctattggataagtctgtttc |
251 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40077848 |
gtttggcttcattcatccaaatctattggataagtctgtttc |
40077889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University