View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0846_low_218 (Length: 238)

Name: NF0846_low_218
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0846_low_218
NF0846_low_218
[»] chr3 (1 HSPs)
chr3 (7-235)||(26485586-26485814)


Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 7 - 235
Target Start/End: Complemental strand, 26485814 - 26485586
Alignment:
7 gtttgcactattggttacttcctcccatatatgatgagccaacaactagagaccagatcgatgtgcctatgactctgaatggtggaaacaaccaaaacga 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||    
26485814 gtttgcactattggttacttcctcccatatatgatgagccaacaactagaaaccagatcgatgtgcctatgactgtgaatggtggaaacaaccaaaacga 26485715  T
107 aatacataaaaccgtggccaattagaaacccattgtggcagcatcaaccattaaaggtgacttatgatatgaattccaatcgtgacggtcaatgacgaac 206  Q
     ||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
26485714 catacatacaaccgtggccaattagaagcccattgtggcagcatcaaccattaaaggttacttatgatatgaattccaatcgtgacggtcaatgacgaac 26485615  T
207 ccataatctaggaactgattgcatagctc 235  Q
    ||||||| |||||||||||||| ||||||    
26485614 ccataatttaggaactgattgcgtagctc 26485586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 881 times since January 2019
Visitors: 6037