View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_low_224 (Length: 225)
Name: NF0846_low_224
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0846_low_224 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 141
Target Start/End: Complemental strand, 45417766 - 45417626
Alignment:
| Q |
1 |
taccctacccctttttattccttctcttgtatcccttcgatttgtttcaactttgaacttacgtattcacaaatataatataaggtatttctttgtttta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45417766 |
taccctacccctttttattccttctcttgtatcccttcgctttgtttcaactttgaacttacgtattcacaaatataatataaggtatttctttgtttta |
45417667 |
T |
|
| Q |
101 |
ttctttcatctcttatgttatcagtatcactgccttctctg |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45417666 |
ttctttcatctcttatgttatcagtatcactgccttctctg |
45417626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 18 times since January 2019
Visitors: 6046